|
|
 | increases intracellular Ca2++ concentrations 12791703(C)
|
|
|
|
| BH3-mimetic compound ABT737 (Oltersdorf et al, 2005)
|
|
|
|
 | Transcription inhibitor that binds DNA at the transcription initiation complex and preventing elongation by RNA polymerase [Wiki].
|
|
|
|
| Sobell H (1985). "Actinomycin and DNA transcription". Proc Natl Acad Sci U S A 82 (16): 5328-31. PMID 2410919.
|
|
|
|
| Ac-Trp-Glu-His-Asp-7-Amino-4-Methylcoumarin
|
|
|
|
| (Cat.# AMC156)
A fluorogenic substrate for detecting caspase-1, caspase-4, and caspase-5 activity.
Excitation max.: 365–380 nm, Emission max.: 430–460 nm
Thornberry, N.A. et al., J. Biol. Chem., 272:17907 (1997)
Thornberry, N.A., and Lazebnik, Y. 1998. Science 281, 1312.
|
|
|
|
| a caspase-1 inhibitor 15507117(C)
|
|
|
|
| 17360653(C): Casp1 inhibitor
|
|
|
|
| theoretical substrate for AMP formation resulting in AMPK activation 14978242(C)
|
|
|
|
| DNA-damaging agent 12654725(C)
|
|
|
|
| aka Doxorubicin hydroxyldaunorubicin
|
|
|
|
| anthracycline antibiotic [Wiki]
|
|
|
|
| a bridged compound based on the caspase-9 amino terminus, which was linked via the thre-
onine at the P2-position 18570872(C)
|
|
|
|
| Aegera Therapeutics Inc., 810 Chemin du Golf, Ile de Soeurs, Quebec H3E1A8, Canada
|
|
|
|
| decreases protein expression of Ciap1 Ciap2 and Xiap within 20 min 18570872-Fig-3b
|
|
|
|
| a pore forming toxin from Aeromonas hydrophila 17186029(C)
|
|
|
|
| induces potassium efflux and activateds caspase-1 inflammasome in a Nalp3-dependent manners 16990137(D)
|
|
|
|
| EGFR kinase inhibitor 15950906(C) 16806820(C)
|
|
|
|
| a specific inhibitor of EGFR kinase 14657239
|
|
|
|
| EGFR kinase IC50=3 nM [Calbio]
|
|
|
|
| ErbB2 kinase IC50>100um [Calbio]
|
|
|
|
| PDGFRkinase IC50>100 uM [Calbio]
|
|
|
|
| Jak2/Stat kinase inhibitor 15950906(C)
|
|
|
|
| SID 26758181 Calbiochem #124005
|
|
|
|
| 1L6-Hydroxymethyl-chiro-inositol-2-(R)-2-O-methyl-3-O-octadecyl-sn-glycerocarbonate
|
|
|
|
| A phosphatidylinositol ether analog that potently and selectively inhibits Akt (PKB) (IC50 of 5.0 µM). Moderately inhibits PI 3-K activity (IC50 = 83.0 µM). Also inhibits the growth of various cancer cell lines with IC50 values in the 1 - 10 µM range
|
|
|
|
| Ref.: Hu, Y., et al. 2000 J. Med. Chem. 43, 3045.
|
|
|
|
| Protease inhibitor 11518704(C)
|
|
|
|
| N-acetyl-leucine-leucine-methionine
|
|
|
|
| Allnal
Calpain inhibitor I
LLNL
InSolution™ ALLN
N-Ac-Leu-leu-norleucinal
CID4332
IN1502
IN1511
MG 101
|
|
|
|
| inhibitor of adenosine kinase (Adk) 16497986(C)
|
|
|
|
| 5'-amino-5'-deoxyadenosine p-toluensulfonate
|
|
|
|
| inhibitor of macropinocytosis 12393678(C)
|
|
|
|
| phosphodiesterase III inhibitor resulting in accumulation of cyclic AMP [6283063] 14978242(C)
|
|
|
|
| acetyltransferase inhibitor 17074756(C)
|
|
|
|
| 11069105(C) inhibitor of oxidative phosphorylation
|
|
|
|
| 12150925(C) an electron transport inhibitor
|
|
|
|
| Wolvetang, E.J., Johnson, K.L., Krauer, K., Ralph, S.J., and Linnane,
A.W. (1994). Mitochondrial respiratory chain inhibitors induce apoptosis. FEBS Lett. 339, 40–44.
|
|
|
|
| adenosine-5'alpha,beta-methylene diphosphate
|
|
|
|
| To exclude the possible adenosine effect in nucleotide-induced AMPK activation, we inhibited 5'-nucleotidase 16497986(C)
|
|
|
|
| FKBP12 binds to the naturally occurring product FK506 and can be homodimerized with FK1012, which consists of two linked molecules of FK506 (31). A synthetic, cell-permeable homodimerizing reagent, AP20187, which has a greatly reduced affinity for endogenous FKBP12 (~250 nM), binds with high affinity (~0.1 nM) to a F36V mutant (Fv) form of FKBP12 (32).
|
|
|
|
| 31. Spencer, D. M., Wandless, T. J., Schreiber, S. L., and Crabtree, G. R. (1993) Science 262, 1019 –1024
|
|
|
|
| 32. Clackson, T., Yang, W., Rozamus, L. W., Hatada, M., Amara, J. F., Rollins, C. T., Stevenson, L. F., Magari, S. R., Wood, S. A., Courage, N. L., Lu, X., Cerasoli, F., Jr., Gilman, M., and Holt, D. A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10437–10442
|
|
|
|
| sodium-meta-arsenite NaAsO2
|
|
|
|
| JNK/SAPK activator arsenite (45) 10232608(C)
|
|
|
|
| 38. Chen, C., and Okayama, H. High-efficiency transformation of mammalian cells by
plasmid DNA. Mol. Cell. Biol., 7: 2745–2752, 1987.
|
|
|
|
| Arsenic chloride 19276070(C)
|
|
|
|
| accumulates autophagosomes under starvation conditions 11060023(C)
|
|
|
|
| Inhibits fusion between autophogosomes and lysosomes 11060023(C)->Hoyvik 1986
|
|
|
|
| inhibitor of acidification of the endosomes 12900525(C)
|
|
|
|
| neutralizes endosomal pH 15711573(C)
|
|
|
|
| inhibitor of intracellular Ca2+ 16497986(C)
|
|
|
|
| 1,2-bis-(o-aminophenoxy)ethane-N,N,N,N-tetraacetic acid tetraacetoxy-methyl ester
|
|
|
|
| a chemical inhibitor of Ikba phosphorylation (49)
|
|
|
|
| 49. Pierce, J. W., Schoenleber, R., Jesmok, G., Best, J., Moore, S. A., Collins, T., and Gerritsen, M. E. (1997) J. Biol. Chem. 272, 21096–21103
|
|
|
|
| A long-acting derivative of cyclic AMP. It is an activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase [Pubchem]
|
|
|
|
| beta-(+/-)-2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid
|
|
|
|
| non-metabolizable analog of leucine
|
|
|
|
| [t-butoxy carbonyl-Asp-fluoromethylketone; abbr. also: BAF, BD-fmk, BD, Boc-D] This compound is a general inhibitor of caspases. It is cell-permeable and inhibits cell death by apoptosis induced by a variety of stimuli in various cell types by preventing the activation of proforms of caspases into their bioactive form (Cheng et al, 1998; Deshmukh et al, 1996; McCarthy et al, 1997). LAST MODIFIED: January 2004
|
|
|
|
| REFERENCES: Cheng Y et al Caspase inhibitor affords neuroprotection with delayed administration in a rat model of neonatal hypoxic-ischemic brain injury. Journal of Clinical Investigation 101(9): 1992-1999 (1998); Deshmukh M et al Genetic and metabolic status of NGF-deprived sympathetic neurons saved by an inhibitor of ICE family proteases. Journal of Cell Biology 135(5): 1341-1354 (1996); McCarthy NJ et al Inhibition of Ced-3/ICE-related proteases does not prevent cell death induced by oncogenes, DNA damage, or the Bcl-2 homologue Bak. Journal of Cell Biology 136(1): 215-227 (1997)
|
|
|
|
| a caspase inhibitor from Enzyme Systems (aka MPbio) 10753878(C)
|
|
|
|
| possibly Boc-Asp(OMe)-Fluoromethylketone
|
|
|
|
| synonyms: Boc-Asp(OMe)-FMK Boc-D9Ome)-FMK
|
|
|
|
| Rsk inhibitor 19274086(C)
|
|
|
|
| Protein kinase C inhibitor 15485654(C)
|
|
|
|
| pan-P38 inhibitor 18458086
|
|
|
|
| 32. Kuma, Y., Sabio, G., Bain, J., Shpiro, N., Marquez, R., and Cuenda, A.
(2005) J. Biol. Chem. 280, 19472–19479
|
|
|
|
| stimulates TLR1/TLR2 15241416(C)
|
|
|
|
| inhibits Arf GDP-GTP exchange 9520417(C)
|
|
|
|
| disrupts Golgi apparatus 16880211(C)
|
|
|
|
| Brefeldin A reversibly inhibits the small GTPase Arf, which leads to retraction of the Golgi membranes back into the ER (17, 27). 12324469(C)
|
|
|
|
| 17. Lippincott-Schwartz, J. (2001) Histochem. Cell Biol. 116, 97–107
27. Ward, T. (2001) J. Cell Biol. 155, 557–570
|
|
|
|
| BFA has been shown to affect intracellular trafficking dramatically by disintegrating the Golgi apparatus and endosomes (Tooze and Hollinshead, 1992; Wood and Brown, 1992; Faundez et al., 1997), cellular compartments that contain Rap1 (Kim et al., 1990; Beranger et al., 1991). 11466412(C)
|
|
|
|
| Beranger F, Goud B, Tavitian A, de Gunzburg J (1991) Association of the Ras-antagoni stic Rap1/ Krev-1 proteins with the Golgi complex. Proc Natl Acad Sci USA 88:1606–1610.
Faundez V, Horng J-T, Kelly RB (1997) ADP ribosylation factor 1 is required for synaptic vesicle budding in PC12 cells. J Cell Biol 138:505–515.
Kim S, Mizoguchi A, Kikuchi A, Takai Y (1990) Tissue and subcellular distributions of the smg-21/ Rap1/ Krev-1 proteins which are partly distinct from those of c-Ras p21s. Mol Cell Biol 10:2645–2652.
Tooze J, Hollinshead M (1992) In AtT20 and HeLa cells brefeldin A induces the fusion of tubular endosomes and changes their distribution and some of their endocytic properties. J Cell Biol 118:813– 830.
Wood SA, Brown WJ (1992) The morphology but not the function of endosomes and lysosomes is altered by brefeldin A. J Cell Biol 119:273–285.
|
|
|
|
| Thiazolidenedione ligand for PPARg
|
|
|
|
| transcriptional activation of acyl-CoA oxidase promoter construct
|
|
|
|
| Pparg agonist 11009565(C)
|
|
|
|
| an IAP antagonist 18621737(C)
|
|
|
|
| 23. Varfolomeev, E., Blankenship, J. W., Wayson, S. M., Fedorova, A. V., Kayagaki, N., Garg, P., Zobel, K., Dynek, J. N., Elliott, L. O., Wallweber, H. J., Flygare, J. A., Fairbrother, W. J., Deshayes, K., Dixit, V. M., and Vucic, D. (2007) Cell 131, 669 – 681
|
|
|
|
| agonist for P2X and P2Y11 receptors 16497986(C)
|
|
|
|
| 2',3'-O-(4-benzoylbenzoyl)-ATP
|
|
|
|
| 26 N-hexanoylsphingosine 9020886(C)
|
|
|
|
| induces a slow increased in Ca2+ , autophagy, and autophagy-dependent cell death 17244528(C)
|
|
|
|
| tha active form of vitamin D3
|
|
|
|
| an analog of 1,25-dihydroxyvitamin D3 which induces a slow increased in Ca2+ , autophagy, and autophagy-dependent cell death 17244528(C)
|
|
|
|
| "1,25-(OH)2vitamin D3" an agonist for VdR 16143103(D)
|
|
|
|
| Calmodulin antagonist 11397791(C)
|
|
|
|
| Calphostin C, Cladosporium cladosporioides, UCN-1028c
|
|
|
|
| A cell permeable, highly specific inhibitor of protein kinase C (IC50 = 50 nM) that interacts with the protein’s regulatory domain by competing at the binding site of diacylglycerol and phorbol esters. Does not compete with Ca2+ or phospholipids. At higher concentrations inhibits myosin light chain kinase (IC50 > 5 µM), protein kinase A (IC50 > 50 µM), protein kinase G (IC50 > 25 µM), and p60v-src (IC50 > 50 µM). Induces apoptotic DNA fragmentation and cell death in HL-60 human promyelocytic leukemia cells. Requires brief exposure to light for activation. Purity: ≥95% by HPLC. CAS 121263-19-2.
Ref.: Jarvis, W.D., et al. 1994. Cancer Res. 54, 1707. Svetlov, S., and Nigami, S. 1993. Biochim. Biophys. Acta 1177, 75. Gopalakrishna, R., et al. 1992. FEBS Lett. 314, 149. Shimamato, H., et al. 1992. Br. J. Pharmacol. 107, 282. Bruns, R.F., et al. 1991. Biochem. Biophys. Res. Commun. 176, 288. Tamaoki, T., et al. 1990. Biotechnology 8, 732. Kobayashi, E., et al. 1989. Biochem. Biophys. Res. Commun. 159, 548.
|
|
|
|
| PucChem CIDs: 5311365 5280780 5890287 5459084 356334
|
|
|
|
| Calyculin A is reported to inhibit PP1 more selectively than PP2A [10692405] 11292821(C)
|
|
|
|
| causes cofilin dephos in neutrophils 12451591(DA)
|
|
|
|
| Inhibits PP2A cataylic subunit - not acid or alkaline phosphatases, or PTPases [2539153]
|
|
|
|
| 7629157(D) induces phos of Ikba
|
|
|
|
| 15485932(D) Ser/Thr phosphatases induces insulin resistance
|
|
|
|
| inhibits both PP1 and PP2a families 17079228(C)
|
|
|
|
| a phosphatase inhibitor for protein phosphatase (PP) 1 and PP2A (50)
|
|
|
|
| 50. Sun, S. C., Maggirwar, S. B., and Harhaj, E. (1995) J. Biol. Chem. 270,
18347–18351
|
|
|
|
| DNA-damaging agent 16571722
|
|
|
|
| DNA topoisomerase inhibitor (CalBio)
|
|
|
|
| Induces apopotosis 16260609
|
|
|
|
| A slowly hydrolyzed cholinergic agonist that acts at both muscarinic and nicotinic receptors
|
|
|
|
| An anticonvulsant used to control grand mal and psychomotor or focal seizures. Its mode of action is not fully understood, but some of its actions resemble those of PHENYTOIN; although there is little chemical resemblance between the two compounds, their three-dimensional structure is similar.
|
|
|
|
| 17446862(C) autophagy inducer
|
|
|
|
| Carbonyl cyanide 3-chlorophenylhydrazone
|
|
|
|
| Inhibits ATP production via irreversible dissipation of the electrochemical gradient 17459875(C)
|
|
|
|
| Cadmium chloride 19276070(C)
|
|
|
|
| MLK inhibitor 16687404(C)
|
|
|
|
| specificity: 15923109(D) 15878863(D) 15525794(D)
|
|
|
|
| MLK inhibitor 16230351(C)
|
|
|
|
| 30. Maroney, A. C., Finn, J. P., Connors, T. J., Durkin, J. T., Angeles, T., Gessner, G., Xu, Z., Meyer, S. L., Savage, M. J., Greene, L. A., Scott, R. W., and Vaught, J. L. (2001) J. Biol. Chem. 276, 25302–25308
|
|
|
|
| whereas ceramide associates preferably with the trans-Golgi
complex (43)
|
|
|
|
| 3-N-(4-fluorophenyl)-2H-pyrazolo[3,4-d]pyrimidine-3,4-diamine
|
|
|
|
| inhibits the mitogen-activated protein kinase-interacting kinase Mnk1 [Pubchem]
|
|
|
|
| Src inhibitor 17646016(C)
|
|
|
|
| AdoRa2a selective agonist 12082090(C)
|
|
|
|
| inhibits formation of clathrin-coated pits 15247273(C)
|
|
|
|
| Wang, LH (1993) J. Cell Biol. 123, 1107–1117
|
|
|
|
| inhibits protein degradation by lysosomes 11163210(C)
|
|
|
|
| Chloroquine inhibits maturation of early endosomes to lysosomes by inhibiting acidification and thus preventing lysosomal degradation (Mellman et al, 1986).
|
|
|
|
| Mellman I, Fuchs R, Helenius A (1986) Acidiication of the endocytic and exocytic pathways. Annu Rev Biochem 55: 663–700
|
|
|
|
| inhibitor of acidification of the endosomes 12900525(C)
|
|
|
|
| Cycloheximide is an inhibitor of protein biosynthesis in eukaryotic organisms, produced by the bacterium Streptomyces griseus. Cycloheximide exerts its effect by interfering with the translocation step in protein synthesis (movement of two tRNA molecules and mRNA in relation to the ribosome) thus blocking translational elongation.
|
|
|
|
| Antibiotic substance isolated from streptomycin-producing strains of Streptomyces griseus. It acts by inhibiting elongation during protein synthesis
|
|
|
|
| Mek inhibitor 19187764(C)
|
|
|
|
| aka CI-1040, CI 1040, PD-184352, PD184352, PD 184352, 2-(2-chloro-4-iodophenylamino)-N-cyclopropylmethoxy-3,4-difluorobenzamide
|
|
|
|
| Tpl2 inhibitor 19754427(C)
|
|
|
|
| 19 Miyoshi, J., Higashi, T., Mukai, H., Ohuchi, T. and Kakunaga, T. (1991) Structure and
transforming potential of the human cot oncogene encoding a putative protein kinase.
Mol. Cell. Biol. 11, 4088–4096
|
|
|
|
| synthetic E.coli typ Lipid-A 10435584(C)
|
|
|
|
| EGFR specific inhibitor 17646016(C)
|
|
|
|
| compound 56
PD153035 Analog 56
CID2857
IN1496
K00042
4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline
|
|
|
|
| ConA is known to label the rough endoplasmic reticulum and the dilated cisternae of the cis-Golgi apparatus structure
|
|
|
|
| Winqvist, L (1979) J. Cell Sci. 39, 101–116
|
|
|
|
| used to dimerize proteins tagged with bacterial gyrase B (GyrB)
|
|
|
|
| synthetic oligodeoxynucleotides of approx 8−30 bases in length that contain one or more CpG motifs of unmethylated CpG dinucleotides in certain base contexts
|
|
|
|
| used as a ligand for TLR9
|
|
|
|
| Sequences are from 5' to 3';
lowercase letters represent phosphorothioate linkage;
uppercase letters represent phosphodiester linkage 3' of the base;
bold letters represent CpG dinucleotides.
|
|
|
|
| used in: 11812998 11130078
|
|
|
|
| tcctggcggggaagt (inhibitory)
|
|
|
|
| ACCGATAACGTTGCCGGTGACGGCACCACG
|
|
|
|
| 5'- ggTGCATCGATGCAgggggG -3'
|
|
|
|
| used in: 15800576 16306936
|
|
|
|
| negative control: gGTGCATCTATGCAGGGGgg
|
|
|
|
| negative control: tcaagtgttctc
|
|
|
|
| Wiki: binds to ganglioside GM1
|
|
|
|
| used for visualizing GM1-gangliosides in lipid rafts 16880211(D)
|
|
|
|
| used in 14716310 without explanation
|
|
|
|
| kinase inhibitor 18456659(C)
|
|
|
|
| beta-cyclodextrin is known to disrupt cholesterol-rich caveolae 18356165(C)
|
|
|
|
| inhibits calcineurin 17519230(C)
|
|
|
|
| inhibits PP2B 17079228(C)
|
|
|
|
| Shortens actin filaments by blocking monomer addition at the fast-growing end of polymers
|
|
|
|
| ROS in cells cause oxidation of DCFH, yielding the fluorescent product
2,7-dichlorofluorescein (DCF) 15265871(C)
|
|
|
|
| 2',7'-dichlorofluorescein diacetate
|
|
|
|
| a Casp3 inhibitor 10692572(C)
|
|
|
|
| glucocorticoid receptor (GR) agonist 16143103(C)
|
|
|
|
| marker for generation of ROS - oxidation products fluoresce
|
|
|
|
| a selective, competitive inhibitor of SphkS [1310683] 12626530(C)
|
|
|
|
| PubChem CIDs: 5353800,4278
|
|
|
|
| A sulfhydryl reagent which oxidizes sulfhydryl groups to the disulfide form. It is a radiation-sensitizing agent of anoxic bacterial and mammalian cells.
|
|
|
|
| 9564042(C): a sulfhydryl-specific oxidant
|
|
|
|
| binds to the KATP-channel maintaining it in an open conformation [12615955(R)] 17287212(C)
|
|
|
|
| blocks insulin release by inhibiting the influx of extracellular Ca2+ 17287212(C)
|
|
|
|
| A cyclic nucleotide derivative that mimics the action of endogenous CYCLIC AMP and is capable of permeating the cell membrane. It has vasodilator properties and is used as a cardiac stimulant. (From Merck Index, 11th ed)
|
|
|
|
| an inhibitor of JNK signaling 15142038(C)
|
|
|
|
| a phosphodiesterase V/VI inhibitor 17292863(C)
|
|
|
|
| contraction mimetic 17292863(C)
|
|
|
|
| 1-chloro-2,4-dinitrobenzene
|
|
|
|
| 9564042(C): an electrophilic compound which acts as a specific inhibitor of Trx
reductase (Novogrodsky et al., 1979; Arner et al., 1995) and thus increases the oxidized form of Trx in vivo.
|
|
|
|
| Novogrodsky,A., Nehring,R.E.J. and Meister,A. (1979) Inhibition of
amino acid transport into lymphoid cells by the glutamine analog L-2-
amino-4-oxo-5-chloropentanoate. Proc. Natl Acad. Sci. USA, 76,
4932–4935.
|
|
|
|
| Arner,E.S., Bjornstedt,M. and Holmgren,A. (1995) 1-Chloro-2,4-
dinitrobenzene is an irreversible inhibitor of human thioredoxin
reductase. Loss of thioredoxin disulfide reductase activity is
accompanied by a large increase in NADPH oxidase activity. J. Biol.
Chem., 270, 3479–3482.
|
|
|
|
| the lipid analog DOPE, which differs from DPPE only by having unsaturated oleic acid in place of saturated palmitic acid and which does not partition in lipid rafts (Legler, D.F., Doucey, M.A., Cerottini, J.C., Bron, C., and Luescher, I.F. (2001). Selective inhibition of CTL activation by a dipalmitoylphospholipid that prevents the recruitment of signaling molecules to lipid rafts. FASEB J. 15, 1601–1603). 12753752
|
|
|
|
| a transfection reagent made by Roche also used for getting polyU into cells 15800576(M)
|
|
|
|
| CID: 16218742 N-(2,3-Dioleoyloxy-1-propyl)trimethylammonium methyl sulfate
|
|
|
|
| A cationic lipids known to facilitate uptake of RNA into cells 14976262(C)
|
|
|
|
| diphenylene iodonium chloride
|
|
|
|
| inhibits endothelial nitric oxide synthase
|
|
|
|
| inhibits inducible nitric oxide synthase
|
|
|
|
| inhibits mitochiodrial NADPH-ubiquinone oxido-reductase
|
|
|
|
| a phospholipid that we have previously shown to partition preferentially into lipid rafts, thus selectively blocking the recruitment of the T cell receptor signaling complex to microdomains without altering their structure (Legler, D.F., Doucey, M.A., Cerottini, J.C., Bron, C., and Luescher, I.F. (2001). Selective inhibition of CTL activation by a dipalmitoylphospholipid that prevents the recruitment of signaling molecules to lipid rafts. FASEB J. 15, 1601–1603). 12753752
|
|
|
|
| dipalmitoyl phosphatidylethanolamine
|
|
|
|
| Dichlororibofuranosylbenzimidazole
|
|
|
|
| An RNA polymerase II transcriptional inhibitor. This compound terminates transcription prematurely by selective inhibition of RNA synthesis. It is used in research to study underlying mechanisms of cellular regulation
|
|
|
|
| 5,6-dichloro-1-beta-D-ribofuranosylbenose
|
|
|
|
| Casein kinase II inhibitor
|
|
|
|
| 5,6-dichloro-1-beta-D-ribofuranosyl-benzimidazole 15142038(C)
|
|
|
|
| PubChem CIDs: 446094,19001,439196
|
|
|
|
| A reagent commonly used in biochemical studies as a protective agent to prevent the oxidation of SH (thiol) groups and for reducing disulphides to dithiols.
|
|
|
|
| dynamin inhibitor 18297073(C)
|
|
|
|
| 31. Macia, E. et al. Dynasore, a cell-permeable inhibitor of dynamin. Dev. Cell 10,
839–850 (2006).
|
|
|
|
| a lysosomal protease inhibitor 16874098(C)
|
|
|
|
| an irreversible cyteine protease inhibitor [Calbio]
|
|
|
|
| an analog of 1,25-dihydroxyvitamin D3 which induces a slow increased in Ca2+ , autophagy, and autophagy-dependent cell death 17244528(C)
|
|
|
|
| A chelating agent (CHELATING AGENTS) that sequesters a variety of polyvalent cations
|
|
|
|
| erythro-9-(2-hydroxy-3-nonyl) adenosine hydrochloride
|
|
|
|
| inhibitor of adenosine deaminase (Ada) 16497986(C)
|
|
|
|
| EgfR inhibitor 14996911(C)
|
|
|
|
| SID 26758671 Calbiochem#328006
|
|
|
|
| 3-(2-Aminoethyl)-5-((4-ethoxyphenyl)methylene)-2,4-thiazolidinedione, HCl
|
|
|
|
| 17-beta-estradiol, E2 ER agonist 16143103(D)
|
|
|
|
| a reagent for detecting Casp1 activation
|
|
|
|
| FMA-YVAD-FMK Caspase 1 FLICA Kit
|
|
|
|
| Immunochemistry Technologies, LLC
|
|
|
|
| a green (FAM =carboxyfluorescein) fluorescent label; an amino acid peptide inhibitor sequence targeted by active caspase 1 (YVAD); and a fluoromethylketone group (FMK) which acts as a leaving group and forms a covalent bond with the active enzyme.
|
|
|
|
| mitochondrial uncoupler 14651849(C)
|
|
|
|
| a PpaRa agonist 14525951(C)
|
|
|
|
| 5,10,15,20-tetrakis(4-sulfonatophenyl) porphyrinato iron (III)
|
|
|
|
| FeTPPS inhibits the biological effects of ONOO– by catalytically decomposing it to nitrate.
It does not interact with NO and exhibits minimal SOD mimetic activity [24].
|
|
|
|
| disrupts Lipid Rafts 15247273(C)
|
|
|
|
| Keller, P (1998) J. Cell Biol. 140, 1357–1367
|
|
|
|
| inhibits aldosterone-induced synthesis of GNAI3 [Calbio]
|
|
|
|
| inhibits FK506-binding protein -> loss of Ca2+ from SR -> decreased PP2B activity and Na+,K+-ATPase [Calbio]
|
|
|
|
| PP2B inhibitor 9880537(D)
|
|
|
|
| Fludarabine monophosphate
|
|
|
|
| irreversible inhibitor of Rsk 17360704(D)
|
|
|
|
| activates adenyl cyclases at 4 uM
|
|
|
|
| increases cyclic-AMP levels
|
|
|
|
| farnesyl transferase inhibitor 12842888(C)
|
|
|
|
| binds PIP3, used as marker for early endosomes 14716310(C)
|
|
|
|
| However, we found that high level expression of the 2X-FYVE domain leads to sequestration of PI(3)P and disruption of PI(3)P-dependent signaling, as indicated by the loss of EEA1 endosomal targeting. `
|
|
|
|
| such vectors are known to function as dominant interfering
proteins, by competing for intracellular PI3P-docking sites.
|
|
|
|
| aka Iressa an anti-EgfR agent 15950906(C)
|
|
|
|
| Hsp90 inhibitor 11779866(C)
|
|
|
|
| an ansamycin antibiotic that inhibits Hsp90 function, 15001580(C)
|
|
|
|
| Certain ansamycin antibiotics, such as geldanamycin, occupy
the ATP/ADP binding pocket of Hsp90 to inhibit its chaperone
activities (23, 24) and, as such, often decrease the cellular
levels of Hsp90 client proteins. 15001580(C)
|
|
|
|
| 23. Stebbins, C. E., Russo, A. A., Schneider, C., Rosen, N., Hartl, F. U., and
Pavletich, N. P. (1997) Cell 89, 239 –250
24. Roe, S. M., Prodromou, C., O’Brien, R., Ladbury, J. E., Piper, P. W., and Pearl,
L.H. (1999) J. Med. Chem. 42, 260–266
|
|
|
|
| GA was previously shown to interact and interfere with the normal functions of Hsp90 (Whitesell et al., 1994). 11864612(C)
|
|
|
|
| Ppara agonist 11009565(C)
|
|
|
|
| tyrosine kinase inhibitor 15485651(C)
|
|
|
|
| Inhibits PKCa PKCb1 PKCb2 PKCg PKCd PKCe 11278339-D
|
|
|
|
| a raft-associated lipid detected using Cy5-cholera toxin 16880211(C)
|
|
|
|
| Monosialoganglioside GM3 ALX-302-005
|
|
|
|
| [II3Neu5AcLacCer] [α-Neu5Ac-(2→3)]-β-Gal(1→4)-β-Glc-(1→1')-Cer]
|
|
|
|
| Inhibits PKCa PKCb PKCm 11278339-D
|
|
|
|
| Inhibits PKCa PKCb PKCg PKCd PKCz 11278339-D
|
|
|
|
| LxRa/b agonist 16143103(C)
|
|
|
|
| PpaRd agonist 14525954(C)
|
|
|
|
| a specific inhibitor of Raf1 16806820(C)
|
|
|
|
| PpaRg agonist 16143103(C)
|
|
|
|
| inhibitor of PKA PKG PKC from Calbiochem 12150925(C)
|
|
|
|
| Src inhibitor 11907028(C)
|
|
|
|
| Humanized monoclonal antibody to ErbB2 gamma1-chain
|
|
|
|
| human-mouse monoclonal rhuMab HER2 gamma1-chain, disulfide with human mouse monoclonal rhuMab
|
|
|
|
| Trastuzumab, Trastuzumab [INN]
|
|
|
|
| Immunoglobulin G1, anti-(human p185neu receptor
|
|
|
|
| Polycyclic dione that has anti-retroviral activity. Inhibits protein kinase C (IC50 = 3.3 mM). Also known to inhibit casein kinase II (IC50 = 6 nM), MAP kinase (IC50 = 4 nM), and the protein tyrosine activities of the insulin receptor (IC50 = 20 - 29 nM) and the epidermal growth factor receptor (IC50 = 35 nM). Purity: ≥95% by HPLC. CAS 548-04-9.
Merck Index: 14, 4863
Ref.: Zhang, W., et al. 1997. Cancer Lett. 120, 31. Agostinis, P., et al. 1995. Biochem. Pharmacol. 49, 1615. Frew, T., et al. 1994. Anticancer Res. 14, 2425. Barnard, D.L., et al. 1992. Antiviral Res. 17, 63. Takahashi, I., et al. 1989. Biochem. Biophys. Res. Commun. 165, 1207.
R: 22; S: 22-36
|
|
|
|
| 3-isobutyl-1-methylxanthine
|
|
|
|
| Inhibits cAMP and cGMP phosphodiesterases which causes increase in cAMP and PKA-act
|
|
|
|
| phosphodiesterase inhibitor 11292821(C)
|
|
|
|
| thromboxane A2/prostaglandin H2 receptor agonist
|
|
|
|
| 7-(3-(3-hydroxy-4-(4'-iodophenoxy)-1-butenyl)-7-oxabicyclo(2.2.1)heptan-2-yl)-5-heptenoic acid
|
|
|
|
| a specific inhibitor of CK1 (24) 18067272(C)
|
|
|
|
| 24. Holler, N., Zaru, R., Micheau, O., Thome, M., Attinger, A., Valitutti, S., Bodmer, J. L., Schneider, P., Seed, B., and Tschopp, J. (2000) Fas triggers an alternative, caspase-8-independent cell death pathway using the kinase RIP as effector molecule, Nat. Immunol. 1, 489-495.
|
|
|
|
| Z-Ile-Glu(OtBu)-Ala-Leu-H
|
|
|
|
| [PSI] Benzyloxycarbonyl-L-Isoleucyl-[(2S)2-Amino-4-(t-Butyloxycarbonyl)Butanoyl]-L-Alanyl-L-Leucinal (M.W. 618.76) C32H50N4O8 [158442-41-2] Synthetic Product Inhibitor for Proteasome M.E. Figueiredo-Pereira, K.A. Berg, and S. Wilk, J. Neurochem., 63, 1578 (1994). E.B.-M. Traenckner, S. Wilk, and P.A. Baeuerle, EMBO J., 13, 5433 (1994). M.E. Figueiredo-Pereira, W-E. Chen, H-M. Yuan, and S. Wilk, Arch. Biochem. Biophys., 317, 69 (1995).
|
|
|
|
| cyclooxygenase inhibitor [7592593]
|
|
|
|
| a cyclooxygenase-1/cyclooxygenase-2 inhibitor [17277110]
|
|
|
|
| a Ca2+ ionophore that serves as a mobile Ca2+ carrier that equilibrates Ca2+ levels across biological membranes, including plasma and ER membranes 17244528(C)
|
|
|
|
| AdRb2 agonist 12082090(C)
|
|
|
|
| Cramer, L. P. (1999). Role of actin-filament disassembly in lamellipodiumprotrusion in motile cells revealed using the drug jasplakinolide. Curr. Bio9, 1095-1105.
|
|
|
|
| Inhinits actin disassemly?
|
|
|
|
| a cell permeable peptide inhibitor from Calbiochem 12738796(C)
|
|
|
|
| metabolite from culture broth of Nocardiopsis sp.; a neurotrophin antag; inhibits BDNF TrkB receptor
|
|
|
|
| staurosporinone
k-252a
k-252b
K252a
3'-(S)-epi-K-252a
K 252a
K 252b
K 252c
K 252d
K-252c
|
|
|
|
| Potassium Dichromate 19276070(C)
|
|
|
|
| Kaede is a recently cloned f luorescent protein that emits bright green fluorescence after its synthesis, which changes efficiently to a stable red fluorescence upon irradiation with 405-nm light, thereby providing a simple and powerful technique for the regional optical labeling of target molecules.
|
|
|
|
| 22. Ando R, Hama H, Yamamoto-Hino M, Mizuno H, Miyawaki A (2002) Proc Natl Acad Sci USA 99:12651–12656.
|
|
|
|
| Kainate, a model excitotoxin, activates both AMPA and kainate receptor subtypes and can induce seizures and hippocampal neuronal apoptosis in vivo (Ferkany et al., 1984; Pollard et al., 1994; Schreiber et al., 1993) as well as trigger cell death in cultured primary neurons (Koh et al., 1990). 12194869(C)
|
|
|
|
| 39. Leclerc, S., Garnier, M., Hoessel, R., Marko, D., Bibb, J. A., Snyder, G. L.,
Greengard, P., Biernat, J., Wu, Y. Z., Mandelkow, E. M., Eisenbrand, G.,
and Meijer, L. (2001) J. Biol. Chem. 276, 251–260
|
|
|
|
| alpha-ketoisocaproic acid
|
|
|
|
| production of glutamate from alpha-ketoglutarate during transamination of leucine to alpha-ketoisocaproic acid [6800820] 17287212(C)
|
|
|
|
| antagonist of P2X7 receptor 16497986(C)
|
|
|
|
| Camk2 inhibitor 16497986(C)
|
|
|
|
| 1-[N,O-bis(5-iso-quinolinesulphonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine
|
|
|
|
| inhibits Camk2 11397791(C)
|
|
|
|
| Ilk inhibitor KP-SD-1 11313365(C)
|
|
|
|
| 17446862(C) autophagy producer
|
|
|
|
| proteasome inhibitor 11684013(C)
|
|
|
|
| 26S proteasome inhibitor 10587642(C)
|
|
|
|
| irreversible proteasome inhibitor 16467847(C)
|
|
|
|
| an inhibitor of actin assembly
|
|
|
|
| blocks phagocytosis by stablizing actin 15711573(C)
|
|
|
|
| Btk inhibitor 15849198(C) 16415872(C)
|
|
|
|
| a synthetic RXR agonist 14525954(C)
|
|
|
|
| Inhibits GSK3 11147790(D)
|
|
|
|
| is a lipid component of an endotoxin held responsible for toxicity of Gram-negative bacteria. It is the innermost of the three regions of the lipopolysaccharide (LPS, also called endotoxin) molecule, and its hydrophobic nature allows it to anchor the LPS to the outer membrane. [Wikipedia]
|
|
|
|
| Z-Leu-Leu-Leu-H (aldehyde)
|
|
|
|
| Benzyloxycarbonyl-L-Leucyl-L-Leucyl-L-Leucinal (M.W. 475.62) C26H41N3O5 [133407-82-6] Synthetic Product Inhibitor for Proteasome and Cathepsin K Y. Saito, S. Tsubuki, H. Ito, and S. Kawashima, Neurosci. Lett., 120, 1 (1990). T.J. Jensen, M.A. Loo, S. Pind, D.B. Williams, A.L. Goldberg, and J.R. Riordan, Cell, 83, 129 (1995). B.J. Votta, M.A. Levy, A. Badger, J. Bradbeer, R.A. Dodds, I.E. James, S. Thompson, M.J.Bossard, T. Carr, J.R. Conner, T.A. Tomaszek, L. Szewczuk, F.H. Drake, D.F. Veber, and M. Gowen, J. Bone Miner. Res., 12, 1396 (1997) • This compound is distributed through Peptide Institute, Inc. under the license of Dr. H. Ito.
|
|
|
|
| Z-Leu-Leu-Nva-H (aldehyde)
|
|
|
|
| [MG-115] Benzyloxycarbonyl-L-Leucyl-L-Leucyl-L-Norvalinal (M.W. 461.59) C25H39N3O5 [133407-86-0] Synthetic Product Inhibitor for Proteasome Y. Saito, S. Tsubuki, H. Ito, and S. Kawashima, Neurosci. Lett., 120, 1 (1990). A. Vinitsky, C. Michaud, J.C. Powers, and M. Orlowski, Biochemistry, 31, 9421 (1992). K.L. Rock, C. Gramm, L. Rothstein, K. Clark, R. Stein, L. Dick, D. Hwang, and A.L. Goldberg, Cell, 78, 761 (1994). V.J. Palombella, O.J. Rando, A.L. Goldberg, and T. Maniatis, Cell, 78, 773 (1994). • This compound is distributed through Peptide Institute, Inc. under the license of Dr. H. Ito.
|
|
|
|
| an inhibitor of Crml nuclear export pathway 16624523(C)
|
|
|
|
| a specific inhibitor of NES-dependent intracellular transport 11265759(C)
|
|
|
|
| a specfic inhibitor for Crm1 (Xpo1)
|
|
|
|
| 17. Fornerod, M., M. Ohno, M. Yoshida, and I. W. Mattaj. 1997. CRM1 is an
export receptor for leucine-rich nuclear export signals. Cell 90:1051–1060.
|
|
|
|
| 39. Ossareh-Nazari, B., F. Bachelerie, and C. Dargemont. 1997. Evidence for a
role of CRM1 in signal-mediated nuclear protein export. Science 278:141–
144.
|
|
|
|
| Lipoteichoic acid, Teichoic acid
|
|
|
|
| lipopolysaccharides with an acyl group anchored to the cell membrane of gram-positive bacteria; functions as an adhesion molecule to facilitate the binding of bacteria to cells, colonization, and invasion; interacts with CD14 to induce NF-kB activation and inflammatory cytokine production; can function as surface antigen
|
|
|
|
| Inhibits Pi3k 16497986(C)
|
|
|
|
| 2-(4-Morpholinyl)-8- phenyl-1(4H)-benzopyran-4-one hydrochloride
|
|
|
|
| a shellfish toxin 17186029(C)
|
|
|
|
| blocks caspase-1 activation, IL1b release, IL18 release irt TLR stimulation 16407890(D)
|
|
|
|
| thiol modifying agent 15896328
|
|
|
|
| F. Tewes, G.F. Bol, R. Brigelius-Flohe, Thiol modulation inhibits the interleukin (IL)-1-mediated activation of an IL-1 receptor-associated protein kinase and NF-kappa B, Eur. J. Immunol. 27
(1997) 3015–3021.
|
|
|
|
| A biguanide hypoglycemic agent used in the treatment of non-insulin-dependent diabetes mellitus not responding to dietary modification. Metformin improves glycemic control by improving insulin sensitivity and decreasing intestinal absorption of glucose. (From Martindale, The Extra Pharmacopoeia, 30th ed, p289)
|
|
|
|
| disrupts cholesterol 12717440(C)
|
|
|
|
| Simons,K.& Toomre,D.Lipid rafts and signal transduction.Nature Rev. Mol. Cell Biol. , 31–39 (2000).
|
|
|
|
| 15793306: therefore relevant to note that in several tumor cell lines,
which may or may not form caveolae, disruption of lipid rafts by extraction of cholesterol with methyl-beta-cyclodextrin can reduce Nfkb activation [15].
|
|
|
|
| 15. Legler DF, Micheau O, Doucey MA, Tschopp J, Bron C: Recruitment
of TNF receptor 1 to lipid rafts is essential for TNFalpha-mediated
NF-kappaB activation. Immunity 2003, 18:655– 664
|
|
|
|
| 15175328(C): disrupts lipid rafts
|
|
|
|
| disrupts lipid rafts by specific cholesterol depletion [Harder, T., Scheiffele, P., Verkade, P., and Simons, K. (1998). Lipid domain structure of the plasma membrane revealed by patching of membrane components. J. Cell Biol. 141, 929–942.
Janes, P.W., Ley, S.C., and Magee, A.I. (1999). Aggregation of lipid rafts accompanies signaling via the T cell antigen receptor. J. Cell Biol. 147, 447–461.]
|
|
|
|
| 14713952(C): depletes cholesterol
|
|
|
|
| a growth factor-independent energy source 17237771(C)
|
|
|
|
| 24 h following transfection, cells were serum-starved for 16 h in serum-free medium containing 4 mM mevalonolactone (COS-1 cells do not contain sufficient amounts of endogenous isoprenoid precursors to farnesylate overexpressed Ras proteins, so medium was supplemented with mevalonolactone to augment available precursors). 10358073(C)
|
|
|
|
| 26S Proteasome inhibitor 10587642(C)
|
|
|
|
| 10.Rock, K. L. et al. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78, 761–771 (1994).
|
|
|
|
| Zlllal
Z-Leu-Leu-Leu-H
zLLL
Z-Leu-leu-leu-al
nchembio790-comp6
Cbz-Leu-Leu-Leu-H
nchembio.130-comp1
Z-LLL-CHO
MG132
BSPBio_001310
KBioGR_000030
KBioSS_000030
C2211_SIGMA
NChemBio.2007.18-comp4
BCBcMAP01_000028
KBio2_000030
KBio2_002598
KBio2_005166
KBio3_000059
KBio3_000060
CHEBI:199755
MG-132
AIDS031965
Bio2_000030
Bio2_000510
AIDS-031965
CID462382
ZINC13476439
Carbobenzoxy-L-leucyl-L-leucyl-L-leucinal
IDI1_033780
NCGC00161679-01
NCGC00161679-02
NCGC00161679-03
UNM000011053701
SR-01000864598-1
BRD-K60230970-001-04-3
L-Leucinamide, N-[(phenylmethoxy)carbonyl]-L-leucyl-N1-[(1S)-1-formyl-3-methylbutyl]-
N-[(benzyloxy)carbonyl]-L-leucyl-N-[(1S)-1-formyl-3-methylbutyl]-L-leucinamide
{(S)-1-[(S)-1-((S)-1-Formyl-3-methyl-butylcarbamoyl)-3-methyl-butylcarbamoyl]-3-methyl-butyl}-carbamic acid benzyl ester
{1-[(S)-(S)-1-((S)-1-Formyl-3-methyl-butylcarbamoyl)-3-methyl-butylcarbamoyl]-3-methyl-butyl}-carbamic acid benzyl ester
{1-[1-(1-Formyl-3-methyl-butylcarbamoyl)-3-methyl-butylcarbamoyl]-3-methyl-butyl}-carbamic acid benzyl ester
133407-82-6
benzyl (S)-4-methyl-1-((S)-4-methyl-1-((S)-4-methyl-1-oxopentan-2-ylamino)-1-oxopentan-2-ylamino)-1-oxopentan-2-ylcarbamate
Benzyl N-[(1S)-3-methyl-1-[[(1S)-3-methyl-1-[[(2S)-4-methyl-1-oxo-pentan-2-yl]carbamoyl]butyl]carbamoyl]butyl]carbamate
|
|
|
|
| Zillal
Zlll-cho
Lll cpd
Z-Leu-leu-leu-al
Z-Leu-leu-leucinal
Z-LLL
Carbobenzoxy-leucyl-leucyl-leucinal
CHEBI:476512
MG 132
Benzyloxycarbonyl-leu-leu-leu-aldehyde
C26H41N3O5
MG132
Benzyloxycarbonyl-leucyl-leucyl-leucinal
CID107707
MG-132
Carbobenzoxyl-leucinyl-leucinyl-leucinal-H
carbobenzyloxy-leucinyl-leucinyl-leucinal
Benzyloxycarbonylleucyl-leucyl-leucine aldehyde
LS-172868
(S)-N-((Phenylmethoxy)carbonyl)-L-leucyl-N-(1-formyl-3-methylbutyl)-L-leucinamide
L-Leucinamide, N-((phenylmethoxy)carbonyl)-L-leucyl-N-((1S)-1-formyl-3-methylbutyl)-
L-Leucinamide, N-((phenylmethoxy)carbonyl)-L-leucyl-N-(1-formyl-3-methylbutyl)-, (S)-
133407-82-6
benzyl 4-methyl-1-(4-methyl-1-((S)-4-methyl-1-oxopentan-2-ylamino)-1-oxopentan-2-ylamino)-1-oxopentan-2-ylcarbamate
|
|
|
|
| a proteasome inhibitor 10713156(C)
|
|
|
|
| ML-7 a MLCK (Mylk) inhibitor 14747473(C)
|
|
|
|
| competitive inhibitor of Prolyl-hydroxylases
|
|
|
|
| dimethyloxalylglycine - an ester of N-oxalylglycine that penetrates cells
|
|
|
|
| an alkylating agent 12110590(C) 7737130(C)
|
|
|
|
| an inducer of JnkS and P38S 12110590(C)
|
|
|
|
| N-methyl-N'-nitro-N-nitroso-guanidine
|
|
|
|
| an alkylating compound 7737130(C)
|
|
|
|
| inhibites transport of proteins from Golgi apparatus 11163183(C)
|
|
|
|
| Uchida, N., Smilowitz, H., Ledger, P.W., and Tanzer, M.L. (1980). Kinetic studies of the intracellular transport of procollagen and fibronectin in human fibroblasts. Effects of the monovalent ionophore, monensin. J. Biol. Chem. 255, 8638–8644.
|
|
|
|
| Monodansylcadaverine (a primary amine 10187805(C))
|
|
|
|
| marker for autophagic vacuoles [7750517] 15607973(C)
|
|
|
|
| 10187805(C): MDC is an inhibitor of transglutaminase, a membrane-bound
enzyme that actively participates in internalization of various
receptor systems (36 – 44).
|
|
|
|
| 36. Folk, J. E., and Chung, S. H. (1973) Adv. Enzymol. 38, 109 –191
|
|
|
|
| 37. Davies, P., Davis, D., Levitzki, F., Maxfield, P., Milhaud, M., Willingham, C., and Pastan, I. (1980) Nature 283, 162–167
|
|
|
|
| 38. Chow, J. C., Condorelli, G., and Smith, R. J. (1998) J. Biol. Chem 273,
4672– 4680
|
|
|
|
| 39. Resink, T. J., Scott Burden, T., Boulanger, C., Weber, E., and Buhler, F. R. (1990) Mol. Pharmacol. 38, 244 –252
|
|
|
|
| 40. Samanta, A. K., Oppenheim, J. J., and Matsushima, K. (1990) J. Biol. Chem. 265, 183–189
|
|
|
|
| 41. Bradley, J. R., Johnson, D. R., and Pober, J. S. (1993) J. Immunol. 12,
5544 –5555
|
|
|
|
| 42. Peavy, D. E., Edmondson, J. W., and Duckworth, W. C. (1984) Endocrinology 114, 753–760
|
|
|
|
| 43. Ray, E., and Samanta, A. K. (1996) FEBS Lett. 378, 235–239
|
|
|
|
| 44. Ray, E., and Samanta, A. K. (1997) Cytokine 9, 587–596
|
|
|
|
| a "danger signal" 17599095(C)
|
|
|
|
| a peptide derived from the protein kinase inhibitor (PKI), myristoylated PKI 14-22 amide
(myr-PKI; #476485), was from Calbiochem. 16581779(C)
|
|
|
|
| inhibitor of mitochondrial respiration 16565215(C)
|
|
|
|
| PubChem CIDs: 12035,94364
|
|
|
|
| The N-acetyl derivative of CYSTEINE. It is used as a mucolytic agent to reduce the viscosity of mucous secretions. It has also been shown to have antiviral effects in patients with HIV due to inhibition of viral stimulation by reactive oxygen intermediates.
|
|
|
|
| 9564042(C): a thiol-based redox compound, Nac, which is also a potent antioxidant.
|
|
|
|
| inhibitor of Slc29a1 16497986(C)
|
|
|
|
| lipooxygenase inhibitor [7592593]
|
|
|
|
| nordihydroguaiaretic acid
|
|
|
|
| A sulfhydryl reagent that is widely used in experimental biochemical studies.
|
|
|
|
| N-ethylmaleimide; Ethylmaleimide
|
|
|
|
| N-Ethylmaleimide (NEM) is a chemical derivative of maleic acid imide or maleic acid. It is a thiol reactive compound commonly used to modify cystine residues in proteins and peptides.
|
|
|
|
| It can be used to irreversibly inhibit the formation of cystine linking in proteins
|
|
|
|
| It has been observed that after addition of NEM vesicular transport was blocked. After identification of the responsible protein it was called N-ethylmaleimide-sensitive factor (NSF).
|
|
|
|
| In lysis buffers, 20 to 25 mM of NEM is used to inhibit de-sumoylation of proteins for Western Blot analysis.
|
|
|
|
| NEM is also used as an inhibitor of deubiquitinases.
|
|
|
|
| inhibits Ca2 uptake through L-type channels 11463795(C)
|
|
|
|
| A bacterial derived potassium ionophore 17186029(C)
|
|
|
|
| blocks caspase-1 activation, IL1b release, IL18 release irt TLR stimulation 16407890(D)
|
|
|
|
| nucleoside transport inhibitor [2866831] 14978242(C)
|
|
|
|
| Promotes tubulin depolymerization (CalBio)
|
|
|
|
| Nocodazole is an antineoplastic agent which exerts its effect by depolymerizing microtubules.
|
|
|
|
| competitive inhibitor of Prolyl-hydroxylases
|
|
|
|
| IUPAC Name: 2-(carboxymethylamino)-2-oxo-acetic acid
|
|
|
|
| disrupts Lipid Rafts 15247273(C)
|
|
|
|
| Anderson, HA (1996) Mol. Biol. Cell 7, 1825–1834
|
|
|
|
| disrupts cholesterol 12717440(C)
|
|
|
|
| Simons,K.& Toomre,D.Lipid rafts and signal transduction.Nature Rev. Mol. Cell Biol. , 31–39 (2000).
|
|
|
|
| Inhibits PP2A cataylic subunit not acid or alkaline phosphatases, or PTPases [2539153]
|
|
|
|
| Okadaic acid inhibits PP2A at concentrations up to 1 M without inhibiting PP1 [10692405] 11292821(C)
|
|
|
|
| an inhibitor of the PP2A family 17079228(C)
|
|
|
|
| inhibitor of oxidative phosphorylation
|
|
|
|
| inhibitor of the mitochondrial F0F1-AT P synthase
|
|
|
|
| Tyrosine phosphatase inhibitor
|
|
|
|
| borellia burgdorferii lipoprotein a TLR2 ligand 11896392(C)
|
|
|
|
| inhibits the sodium pump and blocks the sodium pump component of oxidative phosphorylation and reduces basal oxygen consumption
|
|
|
|
| viral caspase inhibitor 11262391(M)
|
|
|
|
| aka Pam3Cys or BLP - bacterial lipopeptide 12447442(C)
|
|
|
|
| 18. Takeuchi, O. et al. Cutting edge: role of toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 169, 10–14 (2002).
|
|
|
|
| N-palmitoyl-S-dipalmitoylglyceryl (Pam3) Cys-Scr-(Lys)4 (CSK4)
|
|
|
|
| inhibitor of protein tyrosine phosphatases (PTPases) previously shown to be selective in preventing dephosphorylation of FAK and paxillin
10655584(D)33,34.
|
|
|
|
| inhibitor of endocyctosis 12093727(C)
|
|
|
|
| 33.Retta, S. F. et al. Focal adhesion and stress fiber formation is regulated by tyrosine phosphatase activity. Exp. Cell Res. 229, 307–317 (1996).
34.Defilippi, P. et al. p125FAK tyrosine phosphorylation and focal adhesion assembly: studies with phosphotyrosine phosphatase inhibitors. Exp. Cell Res. 221, 141–152 (1995).
|
|
|
|
| 10938077(C) PD144795 is a benzothiophene, which was originally found to inhibit HIV expression (50)
|
|
|
|
| 50. Critchfield, J. W., Butera, S. T., and Folks, T. M. (1996) AIDS Res. Hum. Retroviruses 12, 39 – 46
|
|
|
|
| aka AG1517, Compound 32, SU5271
|
|
|
|
| EGFR kinase IC50=25pM Ki=6pM (CalBio)
|
|
|
|
| inhibits EGFR kinase activity 12952935(D)
|
|
|
|
| EgfR kinase inhibitor 15950906(C)
|
|
|
|
| P38 MAPK inhibitor 15326485(C)
|
|
|
|
| Calbiochem #513030 PD 169316
|
|
|
|
| 4-(4-Fluorophenyl)-2-(4-nitrophenyl)-5-(4-pyridyl)-1H-imidazole
|
|
|
|
| A potent, cell-permeable, and selective p38 MAP kinase inhibitor (IC50 = 89 nM). Inhibition of p38 MAP kinase by PD 169316 blocks apoptosis induced by trophic factor withdrawal in non-neuronal and neuronal cell lines.
|
|
|
|
| PD 184352 is a potent and specific inhibitor of MAPK kinase 1, the enzyme that activates ERK1 and ERK2) [24] 15304344(C)
|
|
|
|
| [24] Sebolt-Leopold, J.S., Dudley, D.T., Herrera, R., Van Becelaere, K., Wiland, A., Gowan, R.C., Tecle, H., Barrett, S.D., Bridges, A., Przybranowski, S., Leopold, W.R. and Saltiel, A.R. (1999) Nat. Med. 5, 810–816.
|
|
|
|
| activates PKC 11283245(C)
|
|
|
|
| activates PKD 11784866(C)
|
|
|
|
| Phosphatidylethanolamine, cephalin
|
|
|
|
| a lysosomal protease inhibitor 16874098(C)
|
|
|
|
| A reversible inhibitor of aspartic proteases. Inhibits cathepsin D, pepsin, renin [Calbio]
|
|
|
|
| A potent oxidant synthesized by the cell during its normal metabolism. Peroxynitrite is formed from the reaction of two free radicals, NITRIC OXIDE and the superoxide anion (SUPEROXIDES)
|
|
|
|
| Catalyzes ADP-Ribosylation of guanine nucleotide-binding regulatory proteins Gi, Go, Gt [Calbiochem]
|
|
|
|
| H2O2 + orthovanadate 10187801(C)
|
|
|
|
| a biguanide widely used to treat type 2 diabetes 17287212(C)
|
|
|
|
| Syk Inhibitor 12435267(D)
|
|
|
|
| cell-permeable myristoylated PKCz pseudosubstrate (Biosource International) 19414597(C)
|
|
|
|
| PKA inhibitor 12150925(C) from Calbiochem
|
|
|
|
| activates PKC 11283245(C)
|
|
|
|
| phorbal 12-myristate,13-acetate
|
|
|
|
| polyadenylic acid, a synthetic RNA analog
|
|
|
|
| a synthetic dsRNA analog made of polyadenylic-polyuridylic acid
|
|
|
|
| a synthetic ssRNA analog made of polycytidylic acid
|
|
|
|
| synthetic dsDNA 16713980(C) unclear as to whether it means:
|
|
|
|
| Double-stranded polymer containing a 2-base repeating unit Poly(dA-dT):Poly(dA-dT)
|
|
|
|
| Double-stranded polymer containing complementary strands Poly(dA):Poly(dT)
|
|
|
|
| a synthetic DNA which may take on a B-form conformation 17618271(C)
|
|
|
|
| 9. Ishii, K. J. et al. A Toll-like receptor-independent antiviral response induced by
double-stranded B-form DNA. Nature Immunol. 7, 40–48 (2006).
|
|
|
|
| polydeoxyinosinic-polydeoxycytidylic acid
|
|
|
|
| synthetic dsDNA 16713980(C) unclear as to whether it means:
|
|
|
|
| Double-stranded polymer containing a 2-base repeating unit Poly(dI-dC):Poly(dI-dC)
|
|
|
|
| Double-stranded polymer containing complementary strands Poly(dI):Poly(dC)
|
|
|
|
| polyguanylic acid, a synthetic RNA analog
|
|
|
|
| polyinosinic acid, a synthetic RNA analog
|
|
|
|
| a synthetic dsRNA analog polyinosinic-polycytidylic acid which is a ligand for TLR3 11607032(D)
|
|
|
|
| an antibiotic that binds to Lipid-A in LPS and blocks "biological effects" 17658277(C)
|
|
|
|
| Duff, G.W., and Atkins, E. (1982). The inhibitory effect of polymyxin B
on endotoxin-induced endogenous pyrogen production. J. Immunol.
Methods 52, 333–340.
|
|
|
|
| Palsson-McDermott, E.M., and O’Neill, L.A. (2004). Signal transduc-
tion by the lipopolysaccharide receptor, Toll-like receptor-4. Immunol-
ogy 113, 153–162.
|
|
|
|
| polyuridylic acid, a synthetic ssRNA analog.
|
|
|
|
| ligand for TLR7 and TLR8 15800576(C)->14976261,14976262
|
|
|
|
| Cr2O72−(aq) + 14H+ + 6e− → 2Cr3+(aq) + 7H2O (E = +1.33 V)
|
|
|
|
| 4-amino-5-(4-methylphenyl)-7-(tert-butyl)pyrazolo(3,4-d)pyrimidine
|
|
|
|
| 10202139(C): a specific inhibitor of Src family kinases (Daub et al., 1997)
|
|
|
|
| Daub,H., Wallasch,C., Lankenau,A., Herrlich,A. and Ullrich,A. (1997)
Signal characteristics of G protein-transactivated EGF receptor.
EMBO J., 16, 7032–7044.
|
|
|
|
| a specific inhibitor of Src kinases 16806820(C)
|
|
|
|
| 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine
|
|
|
|
| a negative control for PP1 and PP2
|
|
|
|
| 4-amino-7-phenylpyrazolo[3,4-d]pyrimidine
|
|
|
|
| reduces cAMP "efflux" 16581779(C)
|
|
|
|
| Inhibits Ikkb 12556537(D) 15778223(C)
|
|
|
|
| 1-hydroxypyridine-2-thione
|
|
|
|
| PyrrolidineDithiocarbamate
|
|
|
|
| a chemical inhibitor of Nfkb 17334236(C)
|
|
|
|
| PyrrolidineDithiocarbonate
|
|
|
|
| a metal chelator 8108390(C)
|
|
|
|
| an antiviral compound 17599095(C)
|
|
|
|
| an antiviral compound 17599095(C)
|
|
|
|
| CID: 159603 synonyms: Resiquimod S28463
|
|
|
|
| believed to mimic bacteria RNA [17785828(C)]
|
|
|
|
| a ligand for TLR7 and TLR8 [16895974]
|
|
|
|
| a known inducer of TLR7 17337443(C)
|
|
|
|
| Inhibits mTOR 11147790(D)
|
|
|
|
| The mode of action of Rapamycin is to bind the FKBP12. The Rapamycin-FKBP12 complex inhibits the mTOR pathway by directly binding the mTOR Complex1 (mTORC1). Rapamycin must bind FKBP12 first, and only the FKBP12-rapamycin complex can bind FRAP/RAFT/mTOR.
|
|
|
|
| an inhibitor of RNA-dependent RNA polymerase transcription 15367631(C)
|
|
|
|
| 35. Patterson, J. L., and R. Fernandez-Larsson. 1990. Molecular mechanisms of
action of ribavirin. Rev. Infect. Dis. 12:1139–1146.
|
|
|
|
| a synthetic ssRNA from HIV-1 U5 region nt 108-127 14976262(C)
|
|
|
|
| 5' GCCCGUCUGUUGUGUGACUC 3'
|
|
|
|
| 5" GsCsCsCsGsUsCsUsGsUsUsGsUsGsUsGsAsCsUsC 3'
|
|
|
|
| phosphothioate protected positions are indicated by ‘s’
|
|
|
|
| Dotap was complexed with the RNA to facilitate uptake
|
|
|
|
| a derivative of RNA40 in which all U's were reaplaced by A's 14976262(D)
|
|
|
|
| 5' GCCCGACAGAAGAGAGACAC 3'
|
|
|
|
| GsCsCsCsGsAsCsAsGsAsAsGsAsGsAsGsAsCsAsC
|
|
|
|
| phosphothioate protected positions are indicated by ‘s’
|
|
|
|
| Dotap was complexed with the RNA to facilitate uptake
|
|
|
|
| a derivative of RNA40 in which all G's were reaplaced by A's 14976262(D)
|
|
|
|
| 5' ACCCAUCUAUUAUAUAACUC 3'
|
|
|
|
| AsCsCsCsAsUsCsUsAsUsUsAsUsAsUsAsAsCsUsC
|
|
|
|
| phosphothioate protected positions are indicated by ‘s’
|
|
|
|
| Dotap was complexed with the RNA to facilitate uptake
|
|
|
|
| actually named: RNA9.2s 17038590
|
|
|
|
| synthetic RNA92s: 5’-OHAGCUUAACCUGUCCUUCAA-3'
|
|
|
|
| IVT RNA92s: 5’-pppAGCUUAACCUGUCCUUCAA-3'
|
|
|
|
| Inhibits PKCs 11147790(D)(36)
|
|
|
|
| inhibitor of cyclin-dependent kinases 16687404(C)
|
|
|
|
| Meijer, L., Borgne, A., Mulner, O., Chong, J. P., Blow, J. J., Inagaki, N., Inagaki, M., Delcros, J. G., and Moulinoux, J. P. (1997) Eur. J. Biochem. 243, 527–536
|
|
|
|
| PPARg agonist 16143103(C) 14525654(C)
|
|
|
|
| PKC inhibitor 14651849(C)
|
|
|
|
| P38 inhibitor 14699082(C) 9069290[7]
|
|
|
|
| 11154262(C) P38g,P38d are insensitive to SB203580
|
|
|
|
| inhibits TgfbR1 15280432(C) 12191474(C)
|
|
|
|
| Inman, G. J., Nicols, F. J., Callahan, J. F., Harling, J. D., Gaster, L. M., Reith, A. D., Laping, N. J. and Hill, C. S. (2002a). SB-431542 is a potent and specific inhibitor of transforming growth factor-βsuperfamily type I activin receptor-like kinase receptors, ALK4, ALK5 and ALK7. Mol. Pharmacol. 62, 65-72.
|
|
|
|
| Laping, N. J., Grygielko, E., Mathur, A., Butter, S., Bomberger, J., Tweed, C., Fornwald, J., Lehr, R., Harling, J. D., Gaster, L. M. et al. (2002). Inhibition of transforming growth factor (TGF)-β1-induced extracellular matrix with a novel inhibitor of the TGF-βtype I receptor kinase activity. Mol. Pharmacol. 62, 58-64.
|
|
|
|
| Ikk2 inhibitor 16371247(C)
|
|
|
|
| [41] A.B. Gomez, C. Mackenzie, A. Paul, R. Plevin, Br. J. Pharmacol. 146 (2005) 217.
[42] Y. Peng, M.R. Power, B. Li, T.J. Lin, J. Leukoc. Biol. 77 (2005) 975.
[43] H. Buss, A. Dorrie, M.L. Schmitz, E. Hoffmann, K. Resch, M. Kracht, J. Biol. Chem. 279 (2004) 55633.
[44] S.J. Jeong, C.A. Pise-Masison, M.F. Radonovich, H.U. Park, J.N. Brady, J. Biol. Chem. 280 (2005) 10326.
|
|
|
|
| A derivative of LOVASTATIN and potent competitive inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HYDROXYMETHYLGLUTARYL COA REDUCTASES), which is the rate-limiting enzyme in cholesterol biosynthesis. It may also interfere with steroid hormone production. Due to the induction of hepatic LDL RECEPTORS, it increases breakdown of LDL CHOLESTEROL.
|
|
|
|
| MKK6 inhibitor 11278290(C)
|
|
|
|
| inhibits p38 MAP kinase; structure in first source
|
|
|
|
| 6-(4-fluorophenyl)-2,3-dihydro-5-(4-pyridinyl)imidazo(2,1-b)thiazole
|
|
|
|
| Previously, our laboratory demonstrated the feasibility of such an approach by preparing a small-molecule mimetic of Smac and showed that it permeates cells readily and acts in a similar fashion as natural Smac in the cell while bypassing mitochondrial regulation (Li et al., 2004). The small-molecule mimetic is a synthetic, two-headed structure designed to resemble the N-terminal amino acid residues (AVPI) of Smac protein that interact with BIR domains of XIAP (Wu et al., 2000). 17996648(C)
|
|
|
|
| Li, L., Thomas, R.M., Suzuki, H., De Brabander, J.K., Wang, X., and Harran, P.G. (2004). A small molecule Smac mimic potentiates TRAIL- and TNFalpha-mediated cell death. Science 305, 1471–1474.
|
|
|
|
| Wu, G., Chai, J., Suber, T.L., Wu, J.W., Du, C., Wang, X., and Shi, Y. (2000). Structural basis of IAP recognition by Smac/DIABLO. Nature 408, 1008–1012.
|
|
|
|
| Nfkb1 Inhibitor 16622218(C)
|
|
|
|
| a cell-permeable peptide that binds to uncomplexed NFkB and prevents nuclear translocation of
NFkB (39).
|
|
|
|
| 39. Lin, Y. Z., Yao, S. Y., Veach, R. A., Torgerson, T. R., and Hawiger, J. (1995)
J. Biol. Chem. 270, 14255–14258
|
|
|
|
| activates soluble guanylate cyclase
|
|
|
|
| (+)-S-Nitroso-N-acetylpenicillamine
|
|
|
|
| S-nitroso-L-cysteine-ethyl-ester 16423564(M)
|
|
|
|
| nitric oxide donor 16423564(C)
|
|
|
|
| slow release NO donor 17018880(C)
|
|
|
|
| HDAC inhibitor 18324520(C)
|
|
|
|
| A four carbon acid, CH3CH2CH2COOH, with an unpleasant odor that occurs in butter and animal fat as the glycerol ester
|
|
|
|
| short-chain fatty acid sodium butyrate (NaBT; ref. 6), a histone deacetylase inhibitor produced in the colon by breakdown of dietary fiber (7).
|
|
|
|
| 6. Wang Q, Wang X, Hernandez A, Kim S, Evers BM. Inhibition of the phosphatidylinositol 3-kinase pathway contributes to HT29 and Caco-2 intestinal cell differentiation. Gastroenterology 2001;120:1381–92.
7. Hague A, Manning AM, Hanlon KA, Huschtscha LI, Hart D, Paraskeva C. Sodium butyrate induces apoptosis in human colonic tumour cell lines in a p53-independent pathway : implications for the possible role of dietary fibre in the prevention of large-bowel cancer. Int
J Cancer 1993;55:498–505.
|
|
|
|
| Butyric acid has been associated with the ability to inhibit the function of histone deacetylase enzymes, thereby favoring an acetylated state of histones in the cell. Acetylated histones have a lower affinity for DNA than non-acetylated histones, due to the neutralisation of electrostatic charge interactions. In general, it is thought that transcription factors will be unable to access regions where histones are tightly associated with DNA (i.e. non-acetylated, e.g., heterochromatin). Therefore, it is thought that butyric acid enhances the transcriptional activity at promoters, which are typically silenced/downregulated due to histone deacetylase activity.
|
|
|
|
| Braf inhibitor 19274086(C)
|
|
|
|
| aka BAY 43-9006, Nexavar, Sorafenib tosylate
|
|
|
|
| 2-Pyridinecarboxamide, 4-(4-((((4-chloro-3-(trifluoromethyl)phenyl)amino)carbonyl)amino)phenoxy)-N-methyl- 4-(4-(3-(4-chloro-3-trifluoromethylphenyl)ureido)phenoxy)pyridine-2-carboxyllic acid methyamide-4-methylbenzenesulfonate
|
|
|
|
| Jnk inhibitor 16687404(C) 15069087(C) 15326485 12738796(C)
|
|
|
|
| Calbiochem Cat#420119 Jnk Inhibitor II
|
|
|
|
| A potent, cell-permeable, selective, and reversible inhibitor of c-Jun N-terminal kinase (JNK) (IC50 = 40 nM for JNK-1 and JNK-2 and 90 nM for JNK-3). The inhibition is competitive with respect to ATP. Exhibits over 300-fold greater selectivity for JNK as compared to ERK1 and p38-2 MAP kinases. Inhibits the phosphorylation of c-Jun and blocks cellular expression of IL-2, IFN-γ, TNF-α, and COX-2. Blocks IL-1-induced accumulation of phospho-Jun and induction of c-Jun transcription. A 50 mM (5 mg/454 µl) solution of JNK Inhibitor II (Cat. No. 420128) in DMSO is also available.
|
|
|
|
| a cAMP analog 10913189(C)
|
|
|
|
| Sp-adenosine 3,5-cyclic monophothioate triethylamine salt
|
|
|
|
| adenylate cyclase inhibitor 11042184
|
|
|
|
| An indolocarbazole that is a potent PROTEIN KINASE C inhibitor which enhances cAMP-mediated responses in human neuroblastoma cells. (Biochem Biophys Res Commun 1995;214(3):1114-20)
|
|
|
|
| general kinase inhibitor??
|
|
|
|
| Pale yellow solid. PROTECT FROM LIGHT. PACKAGED UNDER INERT GAS. A potent, cell-permeable, and broad spectrum inhibitor of protein kinases. Inhibits protein kinase A (IC50 = 7 nM), CaM kinase (IC50 = 20 nM), myosin light chain kinase (IC50 = 1.3 M), Protein kinase C (IC50 = 700 pM), and protein kinase G (IC50 = 8.5 nM). Also inhibits platelet aggregation induced by collagen or ADP but has no effect on thrombin-induced platelet aggregation. Induces apoptosis in human malignant glioma cell lines. Arrests normal cells at the G1 checkpoint. Purity: ≥97% by HPLC. CAS 62996-74-1.
Ref.: Couldwell, W.T., et al. 1994. FEBS Lett. 345, 43. Nishimura, H. and Simpson, I.A. 1994. Biochem. J. 302, 271. Bruno, S., et al. 1992. Cancer Res. 52, 470. Kiss, Z. and Deli, E. 1992. Biochem. J. 288, 853. Vitale, M.L., et al. 1992. Neuroscience 51, 463. Hoffman, R. and Newland, E.S. 1991. Cancer Chemother. Pharmacol. 28, 102. Oka, S., et al. 1986. Agric. Biol. Chem. 50, 2723.
|
|
|
|
| Abl1 inhibitor 16182283(C)
|
|
|
|
| CamkkS inhibitor 16497986(C)
|
|
|
|
| inhibits Camkk2 17459875(C)
|
|
|
|
| inhibits CamKKs [11867640, 12540834] 17519230(C)
|
|
|
|
| 1,8-Naphthoylene benzimidazole-3-carboxylic acid
|
|
|
|
| Src kinase inhibitor [11074000] 12810717(C) 14996911(C)
|
|
|
|
| SU6656 (an indolinone analog) is structurally not related to PP1 (a pyrazolo-pyrimidine) and does not inhibit the autophosphorylation of EGFR and PDGFR [31]. 16182283(C)
|
|
|
|
| [31] R.A. Blake, M.A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, S.A. Courtneidge, SU6656, a selective Src family kinase inhibitor, used to probe growth factor signalling, Mol. Cell. Biol. 20 (2000) 9018 – 9027.
|
|
|
|
| a selective and synthetic LXR agonist 14525954(C)
|
|
|
|
| LxRa/b agonist 16143103(C)
|
|
|
|
| tert-butylhydroquinone (tBHQ)
|
|
|
|
| inhibits ER Ca2+-ATPase 17244528(C)
|
|
|
|
| inhibits the Ca2-ATPase pump to raise intracellular Ca2 11027280(C)
|
|
|
|
| The TIRAP peptide consisted of the antennapedia sequence (RQIKIWFQNRRMKWKK) positioned at the NH2-terminal end of mouse TIRAP aa 138–151.
|
|
|
|
| NK-p-tosyl-L-lysine chloromethyl ketone
|
|
|
|
| Inhibits trypsin-like serine proteinases. Irreversibly inactivates trypsin without affecting chymotrypsin. Prevents nitric oxide production by activated macrophages by interfering with transcription of the iNOS gene. Blocks cell-cell adhesion and binding of HIV-1 virus to the target cells. In macrophages, blocks nitric oxide synthase induced by interferon-g and lipopolysaccharides (EC50 = 80 µM). Prevents endonucleolysis accompanying apoptotic death of HL-60 leukemia cells and normal thymocytes. Purity: ≥95% by elemental analysis. RTECS XT5160000, CAS 4238-41-9.
Ref.: Griscavage, J.M., et al. 1995. Biochem. Biophys. Res. Commun. 215, 721. Kim, H., et al. 1995. J. Immunol. 154, 4741. Bourinbaiar, A.S. and Nagorny, R. 1994. Cell Immunol. 155, 230. Biro, A., et al. 1992. Eur. J. Immunol. 22, 2547. Bruno, S., et al. 1992. Leukemia 6, 1113. Lee, S.F. 1992. Infect. Immun. 60, 4032. Schmidt, H.H., et al. 1992. Mol. Pharmacol. 41, 615.
R: 36/37/38; S: 26-36
|
|
|
|
| Toxin B, Clostridium difficile
|
|
|
|
| inhibts Rho, Rac, Cdc42 by glucosylation of a thronine residue (CalBio)
|
|
|
|
| A glucosyltransferase that covalently links a glucose moiety on a critical threonine residue of Rho, Rac, and Cdc42 (38), thus impairing the docking of the GTPases on their effectors. 15060067(C)
|
|
|
|
| N-tosyl-L-phenylalanine chloromethyl ketone
|
|
|
|
| White solid. Irreversible inhibitor of chymotrypsin. Useful for inhibiting chymotrypsin activity in trypsin preparations. Inhibits apoptosis in thymocytes. Blocks the induction of nitric oxide synthase by g-interferon and lipopolysaccharides (EC50 = 20 µM). Purity: ≥98% by TLC. RTECS XT5613500, CAS 402-71-1.
Ref.: Fearnhead, H.O., et al. 1995. FEBS Lett. 357, 242. Griscavage, J.M., et al. 1995. Biochem. Biophys. Res. Commun. 215, 721. Weaver, V.M., et al. 1993. Biochem. Cell Biol. 71, 488. Murakami, T., et al. 1991. Biochim. Biophys. Acta 1079, 279. Nierodzik, M.L., et al. 1991. J. Clin. Invest. 87, 229. Wilson, W.E., et al. 1989. J. Biol. Chem. 264, 17777.
R: 41; S: 26-36
|
|
|
|
| N,N,N-tetrakis(2-pyridylmethyl)ethylenediamine
|
|
|
|
| depletes zinc 14713952(C)
|
|
|
|
| a specific inhibitor of multiple histone deactylases 11533489(D) (11) H. Kuo, C. D. Allis, Bioessays 20, 615 (1998).
|
|
|
|
| HDAC inhibitor 18324520(C)
|
|
|
|
| trichostatin A
Trichlostatin A
Tricostatin A
nchembio860-comp3
Antibiotic A-300
(R)-Trichostatin A
nchembio.147-comp4
nchembio.275-comp1
nchembio815-comp20
NCGC_TSA
nchembio852-compR31
1c3r
Trichostatin A (TSA)
SGCTO-002
T8552_SIGMA
NChemBio.2007.18-comp3
AIDS096139
C17H22N2O3
AIDS-096139
CID444732
LMPK01000055
Trichostatin A from Streptomyces sp.
A-300-I
NCGC00162453-01
NCGC00162453-02
NCGC00162453-03
LS-74195
A 300
TSA
|
|
|
|
| Pparg agonist 11009565(C)
|
|
|
|
| Thyroid-stimulating hormone, thyrotropin
|
|
|
|
| an inhibitor of agonist-induced PLC activity [21] 9663394(C)
|
|
|
|
| 21. Thompson AK, Mostafapour SP, Denlinger LC, Bleasdale JE, Fisher
SK: The aminosteroid U-73122 inhibits muscarinic receptor
sequestration and phosphoinositide hydrolysis in SK-N-SH
neuroblastoma cells. A role for Gp in receptor compartmentation.
J Biol Chem1991, 266:23856-23862.
|
|
|
|
| 12150925(C) mitochondrial uncoupler
|
|
|
|
| Bernard, P.A., and Cockrell, R.S. (1979). The respiration of brain mitochondria and its regulation by monovalent cation transport. Biochim. Biophys. Acta 548, 173–186.
|
|
|
|
| used when vanadate ion is not specified
|
|
|
|
| (Z)-3-[(2,4-Dimethyl-3-(ethoxycarbonyl)pyrrol-5-yl)methylidenyl]indolin-2-one
VEGF Receptor 2 Kinase Inhibitor I
|
|
|
|
| A highly selective, cell-permeable indolin-2-one class of receptor tyrosine kinase (RTK) inhibitor (IC50 = 70 nM) for murine vascular endothelial growth factor receptor 2 (VEGF-R2; KDR/Flk-1). The inhibition is suggested to be competitive with respect to ATP. Does not inhibit PDGF, EGF, and IGF-1 RTK activities (IC50 > 100 µM).
|
|
|
|
| acts directly on the Ca2 channel to block Ca2[12615955(R)] 17287212(C)
|
|
|
|
| blocks insulin release by inhibiting the influx of extracellular Ca2+ 17287212(C)
|
|
|
|
| microtubule-depolymerizing reagent that inhibits fusion between autophagosomes and lysosomes 111060023(C)->Hoyvik 1986
|
|
|
|
| Inhibits Mlck IC50=200nM (Calbio)
|
|
|
|
| Inhibits PI3K IC50=5nM (Calbio)
|
|
|
|
| PpaRa agonist 12368907(C) 11009565(C) 14525954(C) 10542237(C)
|
|
|
|
| Rock inhibitor 10436159 15536074
|
|
|
|
| Z-Asp-Glu-Val-Asp-fluoromethyl ketone
C110772
benzoylcarbonyl-aspartyl-glutamyl-valyl-aspartyl-fluoromethyl ketone
|
|
|
|
| Z-Ile-Glu(OMe)-Thr-Asp(OMe)-CH2F
|
|
|
|
| A potent, cell-permeable, and irreversible inhibitor of caspase-8 and granzyme B. Effectively inhibits influenza virus-induced apoptosis in HeLa cells. Also inhibits granzyme B. When using with purified native or recombinant enzyme, pretreatment with an esterase is required [CalBiochem].
|
|
|
|
| Ref.: Takizawa, T., et al. 1999. Microbiol. Immunol. 43, 245. Martin, D.A., et al. 1998. J. Biol. Chem. 273, 4345. Sweeney, E.A., et al. 1998. FEBS Lett. 425, 61. Thornberry, N.A., and Lazebnik, Y. 1998. Science 281, 1312.
|
|
|
|
| a Caspase-8 inhibitor 10692572(C)
|
|
|
|
| an aldehyde proteasome inhibitor 8657102(C)
|
|
|
|
| Benzyloxycarbonyl-Leu-Leu-phenylalaninal (Z-LLF-CHO) (49) was a generous gift of M. Orlowski and from Signal Pharmaceuticals. 8657102(M)
|
|
|
|
| 49. Vinitsky, A., C. Michaud, J. C. Powers, and M. Orlowski. 1992. Inhibition of the chymotrypsin-like activity of the pituitary proteinase complex. Biochemistry 31:9421–9428.
|
|
|
|
| slow-binding reversible inhibitor of chymotrypsin-like activity
|
|
|
|
| Z-Llf-CHO
Z-Leu-leu-phe-al, ZLLF
Boc-leu-leu-phe-cho
CID5487496
N-Benzyloxycarbonyl-leucyl-leucyl-phenylalaninal
L-Leucinamide, N-((phenylmethoxy)carbonyl)-L-leucyl-N-(1-formyl-2-phenylethyl)-
N-((Phenylmethoxy)carbonyl)-L-leucyl-N-(1-formyl-2-phenylethyl)-L-leucinamide
143839-79-6
|
|
|
|
| Zinc - used when actual compound is not reported
|
|
|
|
| possible PubChem CIDs: CID:5497171 CID:5716 CID:5497171 CID:5497170
|
|
|
|
| 16940186(C): a pan-caspase inhibitor
|
|
|
|
| 15607973(C): a pan-Caspase (apoptosis) inhibitor
|
|
|
|
| Z-Val-Ala-Asp-Fluoromethylketone
(Cat.# FK109)
An irreversible general caspase inhibitor, non-methylated form.PROTECT FROM MOISTURE. Useful for studies involving recombinant, isolated, and purified caspase enzymes. Unlike Z-VAD(OMe)-FMK (Cat. No. FK009), this inhibitor does not require pretreatment with esterase for in vitro studies.
Komoriya, A. et al., J. Exp. Med., 191:1819 (2000).
Weissner, C. et al., Cell. Mol. Biol., 46:53 (2000).
Misaghi, S., et al. 2004. Chem. Biol. 11, 1677.
|
|
|
|
| glucomannan polysaccharide purified from Saccharomyces cerevisiae
|
|
|
|
| benzyloxycarbonyltyrosyl-valyl-alanyl-aspartic acid fluoromethyl ketone
|
|
|
|
| Z-Tyr-Val-Ala-Asp(OMe)-CH2F
|
|
|
|
| A potent, cell-permeable, and irreversible inhibitor of caspase-1 (ICE), caspase-4, and caspase-5. [CalBiochem Ref.: Thornberry, N.A., and Lazebnik, Y. 1998. Science 281, 1312. Eldadah, B.A., et al. 1997. J. Neurosci. 17, 6105.]
|
|
|
|
| synonyms: 1-butanol n-butanol Butyl alcohol n-butyl alcohol butanol 1-hydroxybutane Butan-1-ol Methylolpropane Propylcarbinol Propylmethanol
|
|
|
|
| As a primary alcohol, inhibits the production of PA via PC-PLD by competition with water during the PLD-dependent displacement of choline from PC, thus yielding phosphatidyl-butanol instead of PA.
|
|
|
|
| blocks cellular gucose utilization by indirectly inhibiting hexokinase 14651849(C)
|
|
|
|
| an imidazoquinoline compound, ligand for TLR7 and TLR8 16737960(C)
|
|
|
|
| an imidazoquinoline compound, ligand for TLR7 and TLR8 16737960(C)
|
|
|
|
| inhibits autophagic sequestration 11266458->Seglen 1982
|
|
|
|
| inhibits class III Pi3k 17244528(C)
|
|
|
|
| inhibits Pi3k 11060023->Blommaart 1997
|
|
|
|
| specific inhibitor of autophagosome formation 11060023->Seglen 1992
|
|
|
|
| Adenosine kinase inhibitor 14978242(C)
|
|
|
|
| The TAK1 inhibitor (5Z-7-oxo-zeaenol) was purchased from AnalytiCon Discovery GmbH (catalog number NP-009245).
|
|
|
|
| 43. Ninomiya-Tsuji, J., Kajino, T., Ono, K., Ohtomo, T., Matsumoto, M., Shiina, M., Mihara, M., Tsuchiya, M., and Matsumoto, K. (2003) J. Biol. Chem. 278, 18485–18490
|
|
|
|
| inhibits cAMP-specific phosphodiesterases IC50 = 25 uM
|
|
|
|
| inhibits cGMP-specific phosphodiesterases IC50=900 nM
|
|
|
|
| antagonist of AdoRa1 and AdoRa2a 9575299(C) 16497986(C)
|
|
|
|
| 8-(sulfophenyl) theophylline
|
|
|
|
|
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}
;){kind=small}